View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17605_low_27 (Length: 255)

Name: NF17605_low_27
Description: NF17605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17605_low_27
NF17605_low_27
[»] chr4 (2 HSPs)
chr4 (145-238)||(11382581-11382674)
chr4 (1-125)||(11382398-11382522)


Alignment Details
Target: chr4 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 145 - 238
Target Start/End: Original strand, 11382581 - 11382674
Alignment:
145 atagtttgtataagctgaagtatacaaaccgagttaaatgagaatccttttgaagcagaagtagtgattgtgctctgtcttcgttgtatacttc 238  Q
    |||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11382581 atagtttgtataagctaaagtatgcaaaccgaattaaatgagaatccttttgaagcagaagtagtgattgtgctctgtcttcgttgtatacttc 11382674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 11382398 - 11382522
Alignment:
1 ttgctaaagcggcgacaaataccgtgagtgttatgattaatgccgacgatacttagcaagataatgcttgattgttatcgttgtacggatttataatgat 100  Q
    ||||||||| ||| | | ||||||| |||||||| ||||||||||| ||||||||||||||||||| |||||||||||||||||||| | ||||||||||    
11382398 ttgctaaagtggccatatataccgttagtgttataattaatgccgatgatacttagcaagataatgtttgattgttatcgttgtacgaaattataatgat 11382497  T
101 tatattttaattaatgaaatgctat 125  Q
    || |||||||||| |||||||||||    
11382498 taaattttaattattgaaatgctat 11382522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University