View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17605_low_27 (Length: 255)
Name: NF17605_low_27
Description: NF17605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17605_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 145 - 238
Target Start/End: Original strand, 11382581 - 11382674
Alignment:
| Q |
145 |
atagtttgtataagctgaagtatacaaaccgagttaaatgagaatccttttgaagcagaagtagtgattgtgctctgtcttcgttgtatacttc |
238 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11382581 |
atagtttgtataagctaaagtatgcaaaccgaattaaatgagaatccttttgaagcagaagtagtgattgtgctctgtcttcgttgtatacttc |
11382674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 11382398 - 11382522
Alignment:
| Q |
1 |
ttgctaaagcggcgacaaataccgtgagtgttatgattaatgccgacgatacttagcaagataatgcttgattgttatcgttgtacggatttataatgat |
100 |
Q |
| |
|
||||||||| ||| | | ||||||| |||||||| ||||||||||| ||||||||||||||||||| |||||||||||||||||||| | |||||||||| |
|
|
| T |
11382398 |
ttgctaaagtggccatatataccgttagtgttataattaatgccgatgatacttagcaagataatgtttgattgttatcgttgtacgaaattataatgat |
11382497 |
T |
 |
| Q |
101 |
tatattttaattaatgaaatgctat |
125 |
Q |
| |
|
|| |||||||||| ||||||||||| |
|
|
| T |
11382498 |
taaattttaattattgaaatgctat |
11382522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University