View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17605_low_28 (Length: 254)
Name: NF17605_low_28
Description: NF17605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17605_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 20 - 228
Target Start/End: Original strand, 27844803 - 27845011
Alignment:
| Q |
20 |
atgacctttgtggtgttagggaggagagagcgaagagtgttgagatgagcgttgattctttgtctgcgtctcctttcagcttctctatgactcttgcatg |
119 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27844803 |
atgaccttagtggtgttagggaggagagagcgaagagtgttgagatgagcgttgattctttgtctgcgtctcctttcagcttctctatgactcttgcatg |
27844902 |
T |
 |
| Q |
120 |
cttcttttgattttctctccgattttgatttgtcacagttgatttcttctaactctttattatccatccaactctcaaacccgtggaatcttcttaaagg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27844903 |
cttcttttgattttctctccgattttgatttgtcacagttgatttcctctaactctttattatccatccaactctcaaacccgtagaatcttcttaaagg |
27845002 |
T |
 |
| Q |
220 |
aggaagcat |
228 |
Q |
| |
|
||||||||| |
|
|
| T |
27845003 |
aggaagcat |
27845011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 82; Significance: 8e-39; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 131 - 228
Target Start/End: Original strand, 20139936 - 20140033
Alignment:
| Q |
131 |
tttctctccgattttgatttgtcacagttgatttcttctaactctttattatccatccaactctcaaacccgtggaatcttcttaaaggaggaagcat |
228 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20139936 |
tttctctctgattttgatttgtcacagttgatttcctctaactatttattatccatccaactctcaaacccgtagaatcttcttaaaggaggaagcat |
20140033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 131 - 228
Target Start/End: Complemental strand, 22192933 - 22192836
Alignment:
| Q |
131 |
tttctctccgattttgatttgtcacagttgatttcttctaactctttattatccatccaactctcaaacccgtggaatcttcttaaaggaggaagcat |
228 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22192933 |
tttctctctgattttgatttgtcacagttgatttcctctaactatttattatccatccaactctcaaacccgtagaatcttcttaaaggaggaagcat |
22192836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 126 - 228
Target Start/End: Complemental strand, 31471856 - 31471754
Alignment:
| Q |
126 |
ttgattttctctccgattttgatttgtcacagttgatttcttctaactctttattatccatccaactctcaaacccgtggaatcttcttaaaggaggaag |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||| || || |||||||||||||||||| |
|
|
| T |
31471856 |
ttgattttctctccgattttgatttgtcacagttgatttcctctaactctttattatccatttaattctcaaacctgtagattcttcttaaaggaggaag |
31471757 |
T |
 |
| Q |
226 |
cat |
228 |
Q |
| |
|
||| |
|
|
| T |
31471756 |
cat |
31471754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 71 - 115
Target Start/End: Original strand, 42062116 - 42062160
Alignment:
| Q |
71 |
ttgattctttgtctgcgtctcctttcagcttctctatgactcttg |
115 |
Q |
| |
|
|||||||| | ||||||||| ||||||||||| |||||||||||| |
|
|
| T |
42062116 |
ttgattctctctctgcgtcttctttcagcttcactatgactcttg |
42062160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University