View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17605_low_29 (Length: 252)
Name: NF17605_low_29
Description: NF17605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17605_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 15 - 237
Target Start/End: Original strand, 38997056 - 38997279
Alignment:
| Q |
15 |
aatatgaaccacaatattcatactgatactactactaacttactnnnnnnnnn-gggacgcttggccatatcctgaattcagtggaaatgagctcactgg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38997056 |
aatatgaaccacaatattcatactgatactactactaccttactaaaaaaaaaagggacgcttggccatatcctgaattcagtggaaatgagctcactgg |
38997155 |
T |
 |
| Q |
114 |
caccatattctgttgggacttgcctcacctccttgcagccccaaaaacttaaccatttgaattcactaacaacaacatgttctgtccaagtccaacaaca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38997156 |
caccatattctgttgggacttgcctcacctccttgcagccccaaaaacttaaccatttgaattcactaacaacaacatgttctgtccaagtccaacaaca |
38997255 |
T |
 |
| Q |
214 |
accaccagttcttgtacaaaagga |
237 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
38997256 |
accaccagttcttgtacaaaagga |
38997279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University