View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17605_low_34 (Length: 240)
Name: NF17605_low_34
Description: NF17605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17605_low_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 17 - 222
Target Start/End: Complemental strand, 2451568 - 2451367
Alignment:
| Q |
17 |
tagtaccactactctaaacattatataaggaaggaattgtttatatgttctcgctccacgtacaagaaagtccactttagtgacacaaaaatgtacataa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2451568 |
tagtaccactactctaaacattatataaggaa----ttgtttaaatgttctcgctccacgtacaagaaagtccactttagtgacacaaaaatgtacataa |
2451473 |
T |
|
| Q |
117 |
agttaacattttagctcccaacaatcaagttttacccttatttctcccttagaatattcccataatctcatctagagatctctcatcggccaggctcagt |
216 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2451472 |
agttaacattttaggtcccaacaatcaagttttacccttatttctcccttagaatattcccataatctcatctagagatctctcatcggccaggctcagt |
2451373 |
T |
|
| Q |
217 |
atcact |
222 |
Q |
| |
|
|||||| |
|
|
| T |
2451372 |
atcact |
2451367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University