View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17606_low_8 (Length: 256)
Name: NF17606_low_8
Description: NF17606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17606_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 16 - 239
Target Start/End: Original strand, 33041501 - 33041724
Alignment:
| Q |
16 |
attatctagcgtcaagtcaaaaattggaaacaaaattggattgactcctctaagtgtgagcaacgcattatagattttgtactgtaaagtgagtaattaa |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33041501 |
attatctagcgtcaagtcaacaattggaaacaaaattggattgattcctctaagtgtgagcaacgcattatagattttgtactgtaaagtgagtaattaa |
33041600 |
T |
 |
| Q |
116 |
ttgattaaattattcagcaatggttactattacatatgtatgtataactaaccatgagtgtattgctatatcaacctttctttgattttcttacttaagc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33041601 |
ttgattaaattattcagcaatggttactattacatatgtatgtataactaaccatgagtgtattgctatatcaacctttctttgattttcttacttaagc |
33041700 |
T |
 |
| Q |
216 |
caaatgccctaaaatttaactacc |
239 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33041701 |
caaatgccctaaaatttaactacc |
33041724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 183 - 235
Target Start/End: Original strand, 33026597 - 33026649
Alignment:
| Q |
183 |
atatcaacctttctttgattttcttacttaagccaaatgccctaaaatttaac |
235 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||| ||| ||| |||||||||| |
|
|
| T |
33026597 |
atatcaaccttcctttgattttcttaattaagccgaatcccccaaaatttaac |
33026649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 183 - 235
Target Start/End: Original strand, 33030941 - 33030993
Alignment:
| Q |
183 |
atatcaacctttctttgattttcttacttaagccaaatgccctaaaatttaac |
235 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||| ||| ||| |||||||||| |
|
|
| T |
33030941 |
atatcaacctttctatgattttcttaattaagccgaatcccccaaaatttaac |
33030993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 239
Target Start/End: Original strand, 33016127 - 33016169
Alignment:
| Q |
197 |
ttgattttcttacttaagccaaatgccctaaaatttaactacc |
239 |
Q |
| |
|
|||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
33016127 |
ttgattttgttacttaagccaaatcccccaaaatttaactacc |
33016169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University