View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17607_high_20 (Length: 291)
Name: NF17607_high_20
Description: NF17607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17607_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 41250121 - 41249863
Alignment:
| Q |
1 |
gttagttagttagttagttctgaagagaagaaattaaagacattggaaagacatgatcaaatgttttgtattatttgagatgaattttatgagactggta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41250121 |
gttagttagttagttagttctgaagagaagaaattaaagacat-ggaaagacatgatcaaatgttttg---------agatgaattttatgagactggta |
41250032 |
T |
 |
| Q |
101 |
tttatttattctgccactggtagttatcagcacagatttggtactttattttcagctggctggatgtgatattgtgatgattgatgtcccacaaaaatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41250031 |
tttatttattctgccactggtagttatcagcacagatttggtactttattttcagctggctggatgtgatattgtgatgattgatgtcccacaaaaatta |
41249932 |
T |
 |
| Q |
201 |
tgagtacattttcaaattttgatgagtttaaagatgaatcgatacaggggtgatttgtaatgtagtgat |
269 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41249931 |
tgagtatattttcaaattttgatgagtttaaagatgaatcgatacaggggggatttgtaatgtagtgat |
41249863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University