View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17607_high_27 (Length: 253)

Name: NF17607_high_27
Description: NF17607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17607_high_27
NF17607_high_27
[»] chr1 (1 HSPs)
chr1 (1-206)||(32040383-32040588)


Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 32040383 - 32040588
Alignment:
1 cggtgaacggcgtggaggatcttttggttctttcattgggaaacggatcgtcgaattcgaagacacgtgagaacgaaaaccgcacgtgctcaacgccgtt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32040383 cggtgaacggcgtggaggatcttttggttctttcattgggaaacggatcgtcgaattcgaagacacgtgagaacgaaaaccgcacgtgctcaacgccgtt 32040482  T
101 aatggttgacattgttcttgacggcgtttccgagacgattgaccaaatgcttggaaacgcattctgttggaatcgtacggattacgtcagaattcaggta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32040483 aatggttgacattgttcttgacggcgtttccgagacgattgaccaaatgcttggaaacgcattctgttggaatcgtacggattacgtcagaattcaggta 32040582  T
201 cgttaa 206  Q
    ||||||    
32040583 cgttaa 32040588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University