View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17607_high_31 (Length: 214)
Name: NF17607_high_31
Description: NF17607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17607_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 11 - 92
Target Start/End: Original strand, 12474205 - 12474286
Alignment:
| Q |
11 |
agtagcataggttgtgacaccgaagaagttatatgtaggaagttcatatttaaactgctttctacgagcatttcttgccttt |
92 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
12474205 |
agtagcttaggttgtgacaccgaagaagttatatgtaggaagttcatatttaaattgctttctacgaacatttcttgccttt |
12474286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 158 - 201
Target Start/End: Original strand, 12474353 - 12474396
Alignment:
| Q |
158 |
tggttattgaaactttttccatcttcaagacatgtaattagtga |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12474353 |
tggttattgaaactttttccatcttcaagacatgtaattagtga |
12474396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University