View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17607_low_16 (Length: 325)
Name: NF17607_low_16
Description: NF17607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17607_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 7 - 305
Target Start/End: Complemental strand, 32040281 - 32039983
Alignment:
| Q |
7 |
tcgactgaaatgaattcaaaaggtttgaaatggttaggtgttgctgatgtggcgcggcatactttccagagttcgaagttgaagctaggagattccgttg |
106 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32040281 |
tcgacggaagtgaattcaaaaggtttgaaatggttaggtgttgctgacgtggcgcggcatactttccagagttcgaagttgaagctaggagattccgttg |
32040182 |
T |
 |
| Q |
107 |
cgtcggctcgtgaaaaaacgaatggagctgaactcttgaggtcaaagcaaggtataagtaatggtttacacgtgtcctttaaagtcaacaaccgtgaatc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32040181 |
cgtcggctcgtgaaaaaacgaatggagctgaactcttgaggtcaaagcaaggtataagcaatggtttacacgtgtcctttaaagtcaacaaccgtgaatc |
32040082 |
T |
 |
| Q |
207 |
ttcttttctgacgaacacttctttcaacacgttatccatgttctttgaagagaatctccggcaccggcgacgaaatactccggttgatttacgtttgta |
305 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32040081 |
ttgttttctgacgaacacttctttcaacacgttatccatgttctttgaagagaatcttcggcaccggcgacgaaatactccggttgatttgcgtttgta |
32039983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University