View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17607_low_18 (Length: 308)
Name: NF17607_low_18
Description: NF17607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17607_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-112; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 9 - 290
Target Start/End: Complemental strand, 26456125 - 26455833
Alignment:
| Q |
9 |
ggtttatactgttattgataagtgtgaaaaaacgaagggagttttagagcttgaggaagnnnnnnntttggagcgtttgtttgcagtcaccaagttcatg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26456125 |
ggtttatactgttattgataagtgtgaaaaaacgaagggagttttagagcttgaggaagaaaaaaatttggagcgtttgtttgcagtcaccaagttcatg |
26456026 |
T |
 |
| Q |
109 |
gataaaatcgtgctaaaatcactcattttaagcatgctgatgcagagtctttgcatgacacatgagagcannnnnnnnattgttactgaaatggtgtcct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26456025 |
gataaaatcgtgctaaaatcactcattttaagcatgctgatgcagagtctttgcatgacacatgagagcattttttttattgttactgaaatggtgtcct |
26455926 |
T |
 |
| Q |
209 |
ggccacgatatagatgagctc-----------aatctcccctcaaaggttgagagccctaataagaaagttggtggatgcttcagctaggaac |
290 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26455925 |
ggccacgatatagatgagctcaaccaaatgaaaatctcccctcaaaggttgagagccctaataagaaagttggtggatgcttcagctgggaac |
26455833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 76 - 176
Target Start/End: Complemental strand, 26456413 - 26456315
Alignment:
| Q |
76 |
ttggagcgtttgtttgcagtcaccaagttcatggataaaatcgtgctaaaatcactcattttaagcatgctgatgcagagtctttgcatgacacatgaga |
175 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||| |||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
26456413 |
ttggagcgtttatttgcagtcaccaagttcatggg--aaatcgtgctaaagtcactcattttgagcatgttgatgcatattctttgcatgacacatgaga |
26456316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 230 - 279
Target Start/End: Complemental strand, 26456248 - 26456199
Alignment:
| Q |
230 |
aatctcccctcaaaggttgagagccctaataagaaagttggtggatgctt |
279 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||| |||| ||||||||| |
|
|
| T |
26456248 |
aatctccactcaaaggttgagagcccaaataagaatgttgttggatgctt |
26456199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University