View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17607_low_24 (Length: 266)
Name: NF17607_low_24
Description: NF17607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17607_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 9472335 - 9472084
Alignment:
| Q |
1 |
ccccaaacgttgtttcactctcttcacttcaactactgtcactgtttttctcttccatannnnnnnnc--aaggatcttcattttcatgcccttcttctt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9472335 |
ccccaaacgttgtttcactctcttcacttcaactactgtcactgtttttctcttccatatttttttttttaaggatcttcattttcatgcccttcttctt |
9472236 |
T |
|
| Q |
99 |
ctaggatcttccatttttttgtgggttgtgtttgannnnnnnnn-cattgaagacaatgaagttttctgaggagaagaatgtttctaacaaccccacaaa |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9472235 |
ctaggatcttccatttttttgtgggttgtgtttgattttttttttcattgaagaaaatgaagttttctgtggagaagaatgtttctaacaaccccacaaa |
9472136 |
T |
|
| Q |
198 |
ttttgaaggtttgataatgattttcatggttaatgggttttgattttgattc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9472135 |
ttttgaaggtttgataatgattttcatggttaatgggttttgattttgattc |
9472084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University