View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17608_low_12 (Length: 209)
Name: NF17608_low_12
Description: NF17608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17608_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 22640149 - 22640364
Alignment:
| Q |
1 |
tcgcttttggctgcg-ctaccactgcgaaaaatccgttagataacggcgttttactgtggatgttttaatnnnnnnnn-ccaagaatactttaaaacaaa |
98 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||||| | ||||||||| |
|
|
| T |
22640149 |
tcgcttttggctgcgtctaccactgcaaaaaatccgttagataacggcgttttactgtggaggttttaataaaaaaaaaccaagaataatctaaaacaaa |
22640248 |
T |
|
| Q |
99 |
catcaaagacttcgggtagtataaatttttgtttaatttgctgaggtta--------------------actaaggttaaagaaaacccctctaaatgaa |
178 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22640249 |
catcaaagacttcgggtagtataaaattttgtttaatttgctgaggttaaagaaaactttgtttaatttactaaggttaaagaaaacccctctaaatgaa |
22640348 |
T |
|
| Q |
179 |
ataaatacttaaaact |
194 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
22640349 |
ataaatacttaaaact |
22640364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University