View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17608_low_12 (Length: 209)

Name: NF17608_low_12
Description: NF17608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17608_low_12
NF17608_low_12
[»] chr7 (1 HSPs)
chr7 (1-194)||(22640149-22640364)


Alignment Details
Target: chr7 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 22640149 - 22640364
Alignment:
1 tcgcttttggctgcg-ctaccactgcgaaaaatccgttagataacggcgttttactgtggatgttttaatnnnnnnnn-ccaagaatactttaaaacaaa 98  Q
    ||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| ||||||||         ||||||||| | |||||||||    
22640149 tcgcttttggctgcgtctaccactgcaaaaaatccgttagataacggcgttttactgtggaggttttaataaaaaaaaaccaagaataatctaaaacaaa 22640248  T
99 catcaaagacttcgggtagtataaatttttgtttaatttgctgaggtta--------------------actaaggttaaagaaaacccctctaaatgaa 178  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||                    |||||||||||||||||||||||||||||||    
22640249 catcaaagacttcgggtagtataaaattttgtttaatttgctgaggttaaagaaaactttgtttaatttactaaggttaaagaaaacccctctaaatgaa 22640348  T
179 ataaatacttaaaact 194  Q
    ||||||||||||||||    
22640349 ataaatacttaaaact 22640364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University