View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17611_high_13 (Length: 361)
Name: NF17611_high_13
Description: NF17611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17611_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 6e-53; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 10 - 179
Target Start/End: Complemental strand, 22069256 - 22069088
Alignment:
| Q |
10 |
tgagatgaagggaggagattcatgttggagttttgttgttaccaacgcggtgccttttttggagaattggagctgtaacgctgaaccctaatacttgtgn |
109 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22069256 |
tgagatggagggaggagattcatgttggagttttgttgttaccaaggcggtgccgtttttggagaattggagctgtaacgctgaaccctaatacttgtg- |
22069158 |
T |
|
| Q |
110 |
nnnnnnnnnnnngacaaaccctaatacttttgttgtttgacgaaaacaaataaagatgtgtattagtgga |
179 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22069157 |
ttttttatttttgacaaaccctagtacttttgttgtttgacgaaaacaaataaagatgtgtatttgtgga |
22069088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 290 - 360
Target Start/End: Complemental strand, 22068946 - 22068876
Alignment:
| Q |
290 |
ctccttttttgtgtacactctatcttttccatagcaaaataaaaaatttcaacttcacattaatcgtagta |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22068946 |
ctccttttttgtgtacactctatcttttccatagcaaaataaaaaatttcaacttcacattaatcgaagta |
22068876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 176 - 261
Target Start/End: Complemental strand, 22069059 - 22068974
Alignment:
| Q |
176 |
tggaagacattttctcttttggataagtttgattccatannnnnnnnctataacaaacaaatgatatactttctctccaacaaaca |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22069059 |
tggaagacattttctcttttggataagtttcattccatattttttttctataacaaacaattgatatactttctctccaacaaaca |
22068974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 105
Target Start/End: Complemental strand, 22062796 - 22062703
Alignment:
| Q |
10 |
tgagatgaagggaggagattcatgttggagttttgttgttaccaacgcggtgccttttttggagaattggagctgtaacgctgaaccctaatactt |
105 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||| || || ||||| ||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
22062796 |
tgagatggagggaggagattcatgatggagttttgttgttacaaaggctgtgcc--gtttggtgaattggagctgaaacgctgaaccctaatactt |
22062703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 105
Target Start/End: Complemental strand, 22087756 - 22087663
Alignment:
| Q |
10 |
tgagatgaagggaggagattcatgttggagttttgttgttaccaacgcggtgccttttttggagaattggagctgtaacgctgaaccctaatactt |
105 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||| || ||||||| | | ||| ||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22087756 |
tgagatggagggaggagattcatattggagttttcttattaccaatacagcgccgttt--ggagaattggagctgaaacgctgaaccctaatactt |
22087663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 226 - 261
Target Start/End: Complemental strand, 22087040 - 22087005
Alignment:
| Q |
226 |
taacaaacaaatgatatactttctctccaacaaaca |
261 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22087040 |
taacaaacaattgatatactttctctccaacaaaca |
22087005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University