View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17611_low_1 (Length: 254)
Name: NF17611_low_1
Description: NF17611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17611_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 88 - 225
Target Start/End: Complemental strand, 49299464 - 49299336
Alignment:
| Q |
88 |
atgcaccaaccgaattagcgtctccttggttttttctattagtaaaagacacatttcatttttatttttgtgcttattggtatgcagagtgttgttttag |
187 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
49299464 |
atgcaccaaccgaattaacgtctccttggttttttctattagtaaaagacacatttcat------ttttgtgcttattggtatgcagagtgttgttttag |
49299371 |
T |
 |
| Q |
188 |
gcgacttcttcttcgattgggtctatgaatctcgtttc |
225 |
Q |
| |
|
| || ||||||||||||||||||||||||||||||| |
|
|
| T |
49299370 |
gtga---cttcttcgattgggtctatgaatctcgtttc |
49299336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 49299509 - 49299463
Alignment:
| Q |
1 |
tggttgattagaaagctgctgagagacatatacattatcatggttat |
47 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
49299509 |
tggttgattagaaagctgcggagagacatatacattatcatggttat |
49299463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University