View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17611_low_3 (Length: 233)
Name: NF17611_low_3
Description: NF17611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17611_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 21 - 220
Target Start/End: Complemental strand, 41378721 - 41378519
Alignment:
| Q |
21 |
gtagggtcggtggcagttggggagtgtggggtttttggtgtgtagtaggttgttctggtgtttggcccttctgctggtaccttgcagctgctggggttgc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41378721 |
gtagggtcggtggcagttggggagtgtggggtttttggtgtgtgggaggttgttttggtgtttggcccttctgctggtaccttgcagctgctggggttgc |
41378622 |
T |
|
| Q |
121 |
tgatgttgttatgcagttgtggctgttttgctggtatagtgcagctgctg---ctgtatttttgctgcagtttgctgcacttaagtgggtgttttccttt |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41378621 |
tgctgttgttatgcagttgtggctgttttgctggtatagtgcagctgctgcttctgtatttttgctgcagtttgctgcacttaagtgggtgttttccttt |
41378522 |
T |
|
| Q |
218 |
gct |
220 |
Q |
| |
|
||| |
|
|
| T |
41378521 |
gct |
41378519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University