View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17612_high_3 (Length: 230)
Name: NF17612_high_3
Description: NF17612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17612_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 14 - 211
Target Start/End: Complemental strand, 6934820 - 6934608
Alignment:
| Q |
14 |
agatgaaaacaggaaattagaaaaatgcatgtaacataaagaggggactgaaaattgagtaggaaatttgaagtttcgacacctattcattatttgatgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | ||||||||| |||||| |
|
|
| T |
6934820 |
agatgaaaacaggaaattagaaaaatgcatgtaacataaagaggggactgaaaattgagtaggaaattcgaagtttcgacatccattcattatatgatgt |
6934721 |
T |
 |
| Q |
114 |
atggtgaaaaataa---------------cagctgttttagtgtccgaatttgagattgaacaaaatcaannnnnnngggaagactatgcaaatgatacc |
198 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6934720 |
atggtgaaaaataaatttcagttcactttcagctgttttagtgtccaaatttgagattgaacaaaatcaatttttttgggaagactatgcaaatgatacc |
6934621 |
T |
 |
| Q |
199 |
tacatgagaagtc |
211 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6934620 |
tacatgagaagtc |
6934608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University