View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17612_low_3 (Length: 230)

Name: NF17612_low_3
Description: NF17612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17612_low_3
NF17612_low_3
[»] chr3 (1 HSPs)
chr3 (14-211)||(6934608-6934820)


Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 14 - 211
Target Start/End: Complemental strand, 6934820 - 6934608
Alignment:
14 agatgaaaacaggaaattagaaaaatgcatgtaacataaagaggggactgaaaattgagtaggaaatttgaagtttcgacacctattcattatttgatgt 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | ||||||||| ||||||    
6934820 agatgaaaacaggaaattagaaaaatgcatgtaacataaagaggggactgaaaattgagtaggaaattcgaagtttcgacatccattcattatatgatgt 6934721  T
114 atggtgaaaaataa---------------cagctgttttagtgtccgaatttgagattgaacaaaatcaannnnnnngggaagactatgcaaatgatacc 198  Q
    ||||||||||||||               ||||||||||||||||| |||||||||||||||||||||||       |||||||||||||||||||||||    
6934720 atggtgaaaaataaatttcagttcactttcagctgttttagtgtccaaatttgagattgaacaaaatcaatttttttgggaagactatgcaaatgatacc 6934621  T
199 tacatgagaagtc 211  Q
    |||||||||||||    
6934620 tacatgagaagtc 6934608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University