View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17613_low_3 (Length: 350)
Name: NF17613_low_3
Description: NF17613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17613_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 137 - 342
Target Start/End: Original strand, 27204751 - 27204956
Alignment:
| Q |
137 |
agaaagagccaaagatgatctgcaccaacactaacaatgcaacctgaattaaccactttagaatagatgttacgatccatgtgctgccagcgttcacctc |
236 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27204751 |
agaaagaaccaaagatgatctgcaccaacactaacaatgcaacctgaattaaccactttggaatagacgttacgatccatgtgctgccagcgttcacctc |
27204850 |
T |
 |
| Q |
237 |
tttagtatgtttttctgttttctgtatccgtgtattgtgtctgtagtgtgcaatatcaactatgaagcactttagttacactctgttgcacctttctgca |
336 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||||| |||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
27204851 |
tttagtatgtttttctgttttttgtattcgtgtattgtgtctgtagtgtgtaatatcaactatgaagcactttcgttacattctgttgcacctttctgca |
27204950 |
T |
 |
| Q |
337 |
cctttg |
342 |
Q |
| |
|
|||||| |
|
|
| T |
27204951 |
cctttg |
27204956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 27203331 - 27203389
Alignment:
| Q |
19 |
agtttatgtattgagtggatgtattcattattagctattgtcactgcagaaaaagggga |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27203331 |
agtttatgtattgagtggatgtattcattattagctattgtcactgcagaaaaagggga |
27203389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 79 - 141
Target Start/End: Original strand, 27203426 - 27203488
Alignment:
| Q |
79 |
aagttgcaccgtttgtgatggtacatgatccaaataacaatgaggttgaggtggcagtagaaa |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27203426 |
aagttgcaccgtttgtgatggtacatgatccaaataacaatgagattgaggtggcagtagaaa |
27203488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University