View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17615_high_9 (Length: 547)
Name: NF17615_high_9
Description: NF17615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17615_high_9 |
 |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0204 (1 HSPs) |
 |  |  |
|
| [»] scaffold0688 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 8e-84; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 8e-84
Query Start/End: Original strand, 238 - 536
Target Start/End: Complemental strand, 29669713 - 29669409
Alignment:
| Q |
238 |
ctttgacggtggaaatttaccgttcagctaaaatcacggtggcaatccacgtttgtagtgaagctaggaatattagcttcttgaaatcacggtagatttg |
337 |
Q |
| |
|
||||| ||| |||||||| |||||| |||||||||| ||||||||||||||| ||||||| |||||||||||||||||||| |||| | | ||||| |
|
|
| T |
29669713 |
ctttggcggaggaaatttcacgttcacctaaaatcacaatggcaatccacgtttatagtgaaactaggaatattagcttcttggaatcgcaacaaatttg |
29669614 |
T |
 |
| Q |
338 |
ctttggttactatgcagatgcacatttggtgaga------ataacgtcttttcaaacagacacttggtcactattgtagtaagaaattttcatacgtttt |
431 |
Q |
| |
|
| |||||||| ||||||||||| ||||||||| |||||| |||||||||||||||||| |||||||||||| |||||||||| || ||||||| |
|
|
| T |
29669613 |
ttgtggttactgtgcagatgcacgtttggtgagggtgaggataacgccttttcaaacagacacttagtcactattgtactaagaaatttccaaacgtttt |
29669514 |
T |
 |
| Q |
432 |
atcaaagatgaaaaggtttttgctttgagatggtgtttaaattttgatttgatcaagtcaaattatgaattgttcaacttgtatggaacaatgtgagaga |
531 |
Q |
| |
|
||||||||| |||| |||||||||||||| |||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
29669513 |
atcaaagattaaaatgtttttgctttgagttggtgtttaaattttgatttgatcaaatcaaattatgaatcgttcaacttgtatggaataatgtgagaga |
29669414 |
T |
 |
| Q |
532 |
tctct |
536 |
Q |
| |
|
||||| |
|
|
| T |
29669413 |
tctct |
29669409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 139; E-Value: 2e-72
Query Start/End: Original strand, 17 - 179
Target Start/End: Complemental strand, 29669888 - 29669726
Alignment:
| Q |
17 |
atttgagacttatgagtgagatacacatggcaatagataactgtcaaatcacaacaggaatatcatcaggttccacaagtcaactaaatttctaagtgtt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29669888 |
atttgagacttatgagtgagatacacatggcaatagataactgtcaaatcacaacaggaatatcatcaggttccacaagtcaactaaatttgtaagtgtt |
29669789 |
T |
 |
| Q |
117 |
tgaagtttggaagtttccaaacaaatatacgaatttagattaatcacatttaaaatatatctt |
179 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||| || |||||||||||||| |
|
|
| T |
29669788 |
tgaagtctggaagtttccaaacaaatatacaaatttagattaattacggttaaaatatatctt |
29669726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 238 - 331
Target Start/End: Original strand, 4707252 - 4707345
Alignment:
| Q |
238 |
ctttgacggtggaaatttaccgttcagctaaaatcacggtggcaatccacgtttgtagtgaagctaggaatattagcttcttgaaatcacggta |
331 |
Q |
| |
|
||||| ||||||||||| | |||||| ||||||||||| |||||||| |||| | ||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
4707252 |
ctttgtcggtggaaattccacattcagccaaaatcacggtagcaatccatgtttattgtgtagctaggaatattagcttcttaaaatcacggta |
4707345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 181 - 237
Target Start/End: Original strand, 36500713 - 36500770
Alignment:
| Q |
181 |
cggttcggatgactttta-cctcaaaactgaatcaaaacgcactgcgaacacctctaa |
237 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||| ||| ||||||||||||||| |
|
|
| T |
36500713 |
cggttcggatgacttttagcctcaaaaccgaatcaaaccgctttgcgaacacctctaa |
36500770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 49; Significance: 9e-19; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 237 - 345
Target Start/End: Original strand, 92185 - 92293
Alignment:
| Q |
237 |
actttgacggtggaaatttaccgttcagctaaaatcacggtggcaatccacgtttgtagtgaagctaggaatattagcttcttgaaatcacggtagattt |
336 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||||| ||||||||||| |||| ||||||| |||| ||||||| ||||||||||| | |||||||| |
|
|
| T |
92185 |
actttgacggaggaaattccacgtttagctaaaatcaccgtggcaatccaagtttatagtgaaactagaaatattaacttcttgaaattattgtagattt |
92284 |
T |
 |
| Q |
337 |
gctttggtt |
345 |
Q |
| |
|
| ||||||| |
|
|
| T |
92285 |
gatttggtt |
92293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 174 - 232
Target Start/End: Complemental strand, 8135441 - 8135382
Alignment:
| Q |
174 |
tatcttgcggttcggatgactttta-cctcaaaactgaatcaaaacgcactgcgaacacc |
232 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||| |||||||||| ||||||||| |
|
|
| T |
8135441 |
tatcttgcggttcggatgacttttagcctcaaaaccgaaccaaaacgcaccgcgaacacc |
8135382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 178 - 236
Target Start/End: Original strand, 892422 - 892481
Alignment:
| Q |
178 |
ttgcggttcggatgactttta-cctcaaaactgaatcaaaacgcactgcgaacacctcta |
236 |
Q |
| |
|
||||||||||||||||||||| ||| |||| |||| |||| ||||| ||||||||||||| |
|
|
| T |
892422 |
ttgcggttcggatgacttttagccttaaaattgaaccaaaccgcaccgcgaacacctcta |
892481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 174 - 232
Target Start/End: Complemental strand, 8064499 - 8064441
Alignment:
| Q |
174 |
tatcttgcggttcggatgacttttacctcaaaactgaatcaaaacgcactgcgaacacc |
232 |
Q |
| |
|
||||||||||||||||||| ||||| | |||||| ||| |||| |||||||||||||| |
|
|
| T |
8064499 |
tatcttgcggttcggatgatttttagcccaaaaccgaactaaaatgcactgcgaacacc |
8064441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 174 - 236
Target Start/End: Original strand, 17144806 - 17144869
Alignment:
| Q |
174 |
tatcttgcggttcggatgactttta-cctcaaaactgaatcaaaacgcactgcgaacacctcta |
236 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||| ||| |||| ||||||||||||||||||| |
|
|
| T |
17144806 |
tatcttgcggtttggatgacttttagcctcaaaaccgaaccaaaccgcactgcgaacacctcta |
17144869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000005; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 174 - 232
Target Start/End: Original strand, 23120334 - 23120393
Alignment:
| Q |
174 |
tatcttgcggttcggatgacttttacc-tcaaaactgaatcaaaacgcactgcgaacacc |
232 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||||| ||||| ||||||||| |
|
|
| T |
23120334 |
tatcttgcggttcggatgacttttaccttcaaaatcgaatcaaaccgcaccgcgaacacc |
23120393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 174 - 230
Target Start/End: Original strand, 36106497 - 36106554
Alignment:
| Q |
174 |
tatcttgcggttcggatgactttt-acctcaaaactgaatcaaaacgcactgcgaaca |
230 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||| |||| ||||| ||||||| |
|
|
| T |
36106497 |
tatcttgcggttcggatgacttttaacctcaaaaccgaaccaaaccgcaccgcgaaca |
36106554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 284 - 331
Target Start/End: Original strand, 46148687 - 46148734
Alignment:
| Q |
284 |
ccacgtttgtagtgaagctaggaatattagcttcttgaaatcacggta |
331 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| || |||| |||||| |
|
|
| T |
46148687 |
ccacgtttgcagtgaagctaggaatattagcttattaaaattacggta |
46148734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 177 - 232
Target Start/End: Original strand, 48293485 - 48293541
Alignment:
| Q |
177 |
cttgcggttcggatgactttt-acctcaaaactgaatcaaaacgcactgcgaacacc |
232 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| |||| |||| ||||||||| |
|
|
| T |
48293485 |
cttgcggttcggatgacttttaacctcaaaaccgaaccaaactgcaccgcgaacacc |
48293541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 174 - 231
Target Start/End: Original strand, 8568631 - 8568689
Alignment:
| Q |
174 |
tatcttgcggttcggatgactttt-acctcaaaactgaatcaaaacgcactgcgaacac |
231 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||| |||| ||||| |||||||| |
|
|
| T |
8568631 |
tatcttgcggttcggatgacttttaacctcaaaaccgaaccaaaccgcaccgcgaacac |
8568689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000008; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 281 - 382
Target Start/End: Complemental strand, 12222047 - 12221946
Alignment:
| Q |
281 |
aatccacgtttgtagtgaagctaggaatattagcttcttgaaatcacggtagatttgctttggttactatgcagatgcacatttggtgagaataacgtct |
380 |
Q |
| |
|
|||||| ||||| |||||| || |||||||||||| || ||||||||||| ||||| |||||||| | || ||||||| |||| |||| |||||||| |
|
|
| T |
12222047 |
aatccatgtttgcagtgaaattaagaatattagcttttttaaatcacggtaaatttgttttggttattgtgtagatgcatctttgatgagggtaacgtct |
12221948 |
T |
 |
| Q |
381 |
tt |
382 |
Q |
| |
|
|| |
|
|
| T |
12221947 |
tt |
12221946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 238 - 313
Target Start/End: Original strand, 12136092 - 12136167
Alignment:
| Q |
238 |
ctttgacggtggaaatttaccgttcagctaaaatcacggtggcaatccacgtttgtagtgaagctaggaatattag |
313 |
Q |
| |
|
||||| ||||||||||| ||||| | ||||||||||| ||||| ||||||| | ||||||||||||||||||| |
|
|
| T |
12136092 |
ctttggcggtggaaattccacgttcgaccaaaatcacggtagcaatgcacgtttattgtgaagctaggaatattag |
12136167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 174 - 231
Target Start/End: Complemental strand, 44336777 - 44336719
Alignment:
| Q |
174 |
tatcttgcggttcggatgactttt-acctcaaaactgaatcaaaacgcactgcgaacac |
231 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||| ||| |||| ||||| |||||||| |
|
|
| T |
44336777 |
tatcttgcggttcggatgacttttaaactcaaaaccgaaccaaaccgcaccgcgaacac |
44336719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000008; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 174 - 242
Target Start/End: Original strand, 40095498 - 40095567
Alignment:
| Q |
174 |
tatcttgcggttcggatgactttt-acctcaaaactgaatcaaaacgcactgcgaacacctctaactttg |
242 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||| ||| |||| ||||| ||||||||| |||| |||| |
|
|
| T |
40095498 |
tatcttgcggttcggataacttttaacctcaaaaccgaaccaaaccgcaccgcgaacacccctaattttg |
40095567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 35980467 - 35980531
Alignment:
| Q |
177 |
cttgcggttcggatgactttta-cctcaaaactgaatcaaaacgcactgcgaacacctctaactt |
240 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||| |||| ||||| || |||||| ||||||| |
|
|
| T |
35980467 |
cttgcggttcggatgacttttagcctcaaaaccgaaccaaaccgcaccgcaaacacccctaactt |
35980531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 232
Target Start/End: Original strand, 27507568 - 27507627
Alignment:
| Q |
174 |
tatcttgcggttcggatgactttta-cctcaaaactgaatcaaaacgcactgcgaacacc |
232 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||| |||| ||||| ||||||||| |
|
|
| T |
27507568 |
tatcttgcggttcggatgacttttattctcaaaaccgaaccaaaccgcaccgcgaacacc |
27507627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 232
Target Start/End: Original strand, 36203520 - 36203579
Alignment:
| Q |
174 |
tatcttgcggttcggatgactttt-acctcaaaactgaatcaaaacgcactgcgaacacc |
232 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||| ||| |||| ||||| ||||||||| |
|
|
| T |
36203520 |
tatcttgcggtttggatgacttttaacctcaaaaccgaaccaaatcgcaccgcgaacacc |
36203579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 174 - 237
Target Start/End: Complemental strand, 12973565 - 12973501
Alignment:
| Q |
174 |
tatcttgcggttcggatgactttta-cctcaaaactgaatcaaaacgcactgcgaacacctctaa |
237 |
Q |
| |
|
||||||||||||||||||||||| | | ||||||| ||| |||| ||||| ||||||||| |||| |
|
|
| T |
12973565 |
tatcttgcggttcggatgactttcagcttcaaaaccgaaccaaaccgcaccgcgaacacccctaa |
12973501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 174 - 231
Target Start/End: Complemental strand, 14528 - 14470
Alignment:
| Q |
174 |
tatcttgcggttcggatgactttt-acctcaaaactgaatcaaaacgcactgcgaacac |
231 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||| |||| ||||| || ||||| |
|
|
| T |
14528 |
tatcttgcggttcggatgacttttaacttcaaaactgaaccaaaccgcaccgcaaacac |
14470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0688 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: scaffold0688
Description:
Target: scaffold0688; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 174 - 230
Target Start/End: Complemental strand, 1164 - 1107
Alignment:
| Q |
174 |
tatcttgcggttcggatgactttta-cctcaaaactgaatcaaaacgcactgcgaaca |
230 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||| |||| | || |||||||| |
|
|
| T |
1164 |
tatcttgcggttcggatgacttttagcctcaaaaccgaaccaaaccacattgcgaaca |
1107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0688; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 174 - 230
Target Start/End: Complemental strand, 7733 - 7676
Alignment:
| Q |
174 |
tatcttgcggttcggatgactttta-cctcaaaactgaatcaaaacgcactgcgaaca |
230 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||| |||| | || |||||||| |
|
|
| T |
7733 |
tatcttgcggttcggatgacttttagcctcaaaaccgaaccaaaccacattgcgaaca |
7676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 174 - 230
Target Start/End: Complemental strand, 34087425 - 34087368
Alignment:
| Q |
174 |
tatcttgcggttcggatgactttta-cctcaaaactgaatcaaaacgcactgcgaaca |
230 |
Q |
| |
|
|||||||| |||| ||||| ||||| |||||||||||||||||| |||||| |||||| |
|
|
| T |
34087425 |
tatcttgcagttcagatgatttttaacctcaaaactgaatcaaaccgcactccgaaca |
34087368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 177 - 232
Target Start/End: Original strand, 27572125 - 27572181
Alignment:
| Q |
177 |
cttgcggttcggatgactttt-acctcaaaactgaatcaaaacgcactgcgaacacc |
232 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| |||| ||||| || |||||| |
|
|
| T |
27572125 |
cttgcggttcggatgacttttaacctcaaaaccgaaccaaaccgcaccgcaaacacc |
27572181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University