View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17615_low_28 (Length: 372)
Name: NF17615_low_28
Description: NF17615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17615_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 123 - 358
Target Start/End: Complemental strand, 36578121 - 36577887
Alignment:
| Q |
123 |
ttgataacccaaaatcaaggcacatcannnnnnnnnnctttctctttcacgcattgcaaattaatatactcttcccattcccaccgaaagaaaagtggaa |
222 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36578121 |
ttgataacccaaaatcaaggcacatcaaaatttttc-ctttctctttcacgcattgcatattaatatactcttcccattcccaccgaaagaaaagtggaa |
36578023 |
T |
 |
| Q |
223 |
atgcatgtgaacatccttatcacgtgatatatgtaaagtttcttttcttctttgtgattggctctgtggcattatagaatccattgaaaatgttggcctg |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36578022 |
atgcatgtgaacatccttatcacgtgatatatgtaaagtttcatttcttctttgtaattggctctgtggcattatagaatccattgaaaatgttggcctg |
36577923 |
T |
 |
| Q |
323 |
caaacagtttaggtaactgccctcactgttctctct |
358 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36577922 |
caaacagtttaggtaactgccctcagtgttctctct |
36577887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University