View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17615_low_35 (Length: 348)
Name: NF17615_low_35
Description: NF17615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17615_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 70 - 336
Target Start/End: Complemental strand, 30463123 - 30462857
Alignment:
| Q |
70 |
agaatatgcctcatcattttttgaaaggctggccagtatcaaaattgactgcacttacagaaaaccgctataaatgtttatattgtttctatggcaataa |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30463123 |
agaatatgcctcatcattttttgaaaggcttgccagtatcaaaattgactgcacttacagaaaaccgctataaatgtttatattgtttctatggcaataa |
30463024 |
T |
|
| Q |
170 |
cataattggaagacaatttctacactccttactaaaagtggatattgttccgttgttgtcttgtccaccactaaatatgagaccaatgtcctatggactt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30463023 |
cataattggaagacaatttctacactccttactaaaagtggatattgttccgttgttgtcttgtccaccactaaatatgagaccaatgtcctatggactt |
30462924 |
T |
|
| Q |
270 |
agtttaatcggcagagacgttgcagtatgtaaaggcggcgtttagaccccaattcctcacttattca |
336 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30462923 |
agtttaatcggtagagacgttgcagtatgtaaagacggcgtttagaccccaattcctcacttattca |
30462857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University