View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17615_low_38 (Length: 315)
Name: NF17615_low_38
Description: NF17615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17615_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 95 - 300
Target Start/End: Original strand, 39057997 - 39058202
Alignment:
| Q |
95 |
ctctagcaataccgatgcatgtcatcctcataatattcttctagacttgattttgatttctttactattggcttaatttttaatatagcaaaattattag |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39057997 |
ctctagcaataccgatgcatgtcatcctcataatattcttctagacttgattttgatttctttactattggcttaatttttaatatagcaaaatgattag |
39058096 |
T |
 |
| Q |
195 |
atgtatgtgtgcannnnnnnnnacacaagatacatataaattgnnnnnnntcgtggatatcaaaacttttctccggtcgtcaaacataacatgttcaagt |
294 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39058097 |
atgtatgtgtgcatttttttttacacaagatacgtataaattgaaaaaaaccgtggatatcaaaacttttctccggtcgtcaaacataacatgttcaagt |
39058196 |
T |
 |
| Q |
295 |
aagaga |
300 |
Q |
| |
|
|||||| |
|
|
| T |
39058197 |
aagaga |
39058202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University