View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17615_low_39 (Length: 314)
Name: NF17615_low_39
Description: NF17615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17615_low_39 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 3 - 174
Target Start/End: Complemental strand, 21141766 - 21141594
Alignment:
| Q |
3 |
ataaaatagtatggttg-atacgttttagatagtttttattttgaatcaatttttgaattatctaatttgactaaacaatgtttcacctaattaacttgt |
101 |
Q |
| |
|
|||||||| |||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |||||||||| |||| |
|
|
| T |
21141766 |
ataaaataatatggttggatacgtttgagatagtttttattttgaatcaatttttgaattatctaaattgactaaacaaagtttaacctaattaatttgt |
21141667 |
T |
|
| Q |
102 |
ttgtgaatttgaaatggaccgagtttgagctaaaaaacatgtttgtatcgaactcaaatcgagttttaaacaa |
174 |
Q |
| |
|
|||||||||||||||| || |||| |||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
21141666 |
ttgtgaatttgaaatgaacaaagttcgagctaaaaaacatgtttttatcgaactcaaattgagttttaaacaa |
21141594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 204 - 286
Target Start/End: Complemental strand, 21141532 - 21141449
Alignment:
| Q |
204 |
aacatcctagatggtcaaattggggggattgcatttaatttc-aaaatcattggattgcatcattagatagaatgggaagatct |
286 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||| ||||||||| |||||||| || |||||||||||||||||| |
|
|
| T |
21141532 |
aacatcctagatgctcaaattggggtaattgcatttaatttcaaaaatcattagattgcatatttggatagaatgggaagatct |
21141449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University