View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17615_low_41 (Length: 309)
Name: NF17615_low_41
Description: NF17615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17615_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 10 - 159
Target Start/End: Complemental strand, 1640033 - 1639884
Alignment:
| Q |
10 |
attatacttgtgacttattcatttcaagttggtttttcttatttcttcattttcttcccatgacacctttgatgtttaattactcataggtgcaattgca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1640033 |
attatacttgtgacttattcatttcaagttggtttttcttatttcttcattttcttcccatgacacctttgatgtttaattactcataggtgcaattgca |
1639934 |
T |
 |
| Q |
110 |
tgatttggattgaaggtagataagtgttttactaatttctgcgagagagg |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1639933 |
tgatttggattgaaggtagataagtgttttactaatttctgcgagagagg |
1639884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 221 - 293
Target Start/End: Complemental strand, 1639822 - 1639746
Alignment:
| Q |
221 |
ctgagaaatgaatgataaatagcaagagagagtaatgaa----gatagataaagagatcgacagaaagagagggatt |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1639822 |
ctgagaaatgaatgataaatagcaagagagagtaatgaagatcgatagataaagagatcgacagaaagagagggatt |
1639746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University