View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17615_low_51 (Length: 259)
Name: NF17615_low_51
Description: NF17615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17615_low_51 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 41835760 - 41835990
Alignment:
| Q |
1 |
aaaatggaagtaaaattaagtggagaacattagagactaatatgttttaaaatatggaaacagagttgcacaaatatgtaatatttgagagatgagagat |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
41835760 |
aaaatggaagtaaaattaaggggagaacattagagactaatatgtttaaaaatatggaagcagaattgcacaaatatgtaatacttgagagatgagagat |
41835859 |
T |
|
| Q |
101 |
taaaaattaaataacgnnnnnnnagagtttggtttgagagttggtgtgtatccatataataagttttattttggtgtgaaattagtttgttcttcacttc |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41835860 |
taaaaattaaataacgtttttttagagtttggtttgagagttggtgtgtatccatataataagttttattttggtgtgaaattagtttg--------ttc |
41835951 |
T |
|
| Q |
201 |
tttggtatgcttggttttagtttggttaattttgttaat |
239 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41835952 |
tttggtatgctttgttttagtttggttaattttgttaat |
41835990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University