View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17615_low_63 (Length: 232)
Name: NF17615_low_63
Description: NF17615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17615_low_63 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 210
Target Start/End: Complemental strand, 49511332 - 49511141
Alignment:
| Q |
19 |
tatattcactgtcaaacaagataaccccattggagcaactctaattggaagagcttatgttccagttgaacaagtcataaagggcaacatagtgaataca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49511332 |
tatattcactgtcaaacaagataaccccattggagcaactctaattggaagagcttatgttccagttgaacaagtcataaagggcaacatagtgaataca |
49511233 |
T |
|
| Q |
119 |
tgggttaatatattagatgtagatcatcgtccaatacaaggcggttccaaaattcatgttcaaatacaattctcacatgttaaaaatgatcc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49511232 |
tgggttaatatattagatgtagatcatcatccaatacaaggcggttccaaaattcatgttcaaatacaattctcacatgttaaaaatgatcc |
49511141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 75
Target Start/End: Complemental strand, 49522280 - 49522226
Alignment:
| Q |
21 |
tattcactgtcaaacaagataaccccattggagcaactctaattggaagagctta |
75 |
Q |
| |
|
|||||||||||||| | ||||| || ||||| ||||||||||| ||||||||||| |
|
|
| T |
49522280 |
tattcactgtcaaagatgataatccgattggtgcaactctaataggaagagctta |
49522226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University