View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17616_high_10 (Length: 349)
Name: NF17616_high_10
Description: NF17616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17616_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 4 - 339
Target Start/End: Original strand, 50390410 - 50390747
Alignment:
| Q |
4 |
acatacgatgatgtccatattgttcagaaatgggataagggctgcacatcgaagcagaagttgatttttcagcgttggtaaccgtgatcgctcagaggat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| ||| |
|
|
| T |
50390410 |
acatacgatgatgtccatattgttcagaaatgggataagggctgcacatcgaagcagaagttgatttttcagagttggtaatcgtgatcgctcagaagat |
50390509 |
T |
 |
| Q |
104 |
aacgggaatttgttaatctagtgttttcaactgcagtatgcatctgttttgttgggcaatgccctgagcttctaccctaaccggtttagttact---ttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
50390510 |
aacgggaatttgttaatctagtgttttcaactgcagtatgcatctgttttgttgggcaatgccctgagcttctaccctaaccggtttagttactttcttg |
50390609 |
T |
 |
| Q |
201 |
atttaatgtcttgtgnnnnnnnnnatctacaccgaattcttctagtaattttgcaggtaaaacaatcttttcaacgtgattgctgctagtttgttaaaaa |
300 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
50390610 |
atttaatgtcttgtgtttttttttatctacaccgaatt-ttctagtaattttgcaggtaaaacaatcttttcaacatgattgctgttagtttgttaaaaa |
50390708 |
T |
 |
| Q |
301 |
gtgttccggatattgctaaaatatatacttttttctgtg |
339 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
50390709 |
gtgttccggatattgctaaaatatatgcttttttctgtg |
50390747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University