View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17616_high_16 (Length: 285)
Name: NF17616_high_16
Description: NF17616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17616_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 30 - 274
Target Start/End: Original strand, 18539840 - 18540080
Alignment:
| Q |
30 |
tattgttgttattgttactcatgaagttttagattttagagagattttgccgccatttaaattaaactccgcagttttatactaaaatggcattggatat |
129 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18539840 |
tattattgttattgttactcatgaagttttagattttagagagattttgccgccatttaaattaaactccgcagttttacactaaaatggcattggatat |
18539939 |
T |
 |
| Q |
130 |
taatcagagagtaagcattatgatattcaattcaactaatagtattttataaatgatgaagttgcatgttgatctttttatatccannnnnnnnnnnnat |
229 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| ||| |||||||| || |
|
|
| T |
18539940 |
taatcagagagtaagcattatgatatt---ttcaagtaatagtattttataaatgatgaagttgcatgttgatatttatatatcca-ttttttgttttat |
18540035 |
T |
 |
| Q |
230 |
ataagcggttcaagaaattagaagtattatgattatgatgagtat |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18540036 |
ataagcggttcaagaaattagaagtattatgattatgatgagtat |
18540080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University