View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17616_high_26 (Length: 218)
Name: NF17616_high_26
Description: NF17616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17616_high_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 30726327 - 30726510
Alignment:
| Q |
1 |
tgaaactatggtagataagttttaaagacaatttagaaaattgataagttcgacctacaaaattttctcaatgnnnnnnnagaggagttttttcaatgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
30726327 |
tgaaactatggtagataagttttaaagacaatttagaaaattgataagttcgacctacaaaattttctcaatgtttttttagtggagttttttcaatgtt |
30726426 |
T |
 |
| Q |
101 |
aaatgcaataaccaatttacaaaattgataaatggataataaaaaattgagttgaggagctaattcggaaaacaataaaagcag |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30726427 |
aaatgcaataaccaatttacaaaattgataaatacaaaataaaaaattgagttgaggagctaattcggaaaacaataaaagcag |
30726510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University