View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17617_high_18 (Length: 248)
Name: NF17617_high_18
Description: NF17617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17617_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 7e-67; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 51 - 238
Target Start/End: Complemental strand, 28654934 - 28654744
Alignment:
| Q |
51 |
tccgagaggcgactcctagcatgtgtataagatga---cataaacataccattgcaataccgtctctcgcagaaagagcgacaatgtcagcacatgacac |
147 |
Q |
| |
|
|||||||||| ||||||| |||||||||| ||||| |||| |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||| |
|
|
| T |
28654934 |
tccgagaggcaactcctaacatgtgtatatgatgatgacatagacataccattgcaataccgtctctagcagaaagagcaacaatatcagcacatgacac |
28654835 |
T |
|
| Q |
148 |
tgtcaagggacattctttctcgacagcagctttgatggtgttcacatacttgaagtttctcatcccaaaacttctcactgatctctgctcc |
238 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||| |||||||| |
|
|
| T |
28654834 |
tgtcaagggacattctttctcaacagcagctttgatggtgttcacatacttgaaatttctcatcccaaaacttcttaccgatgtctgctcc |
28654744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 71 - 238
Target Start/End: Complemental strand, 28635630 - 28635463
Alignment:
| Q |
71 |
atgtgtataagatgacataaacataccattgcaataccgtctctcgcagaaagagcgacaatgtcagcacatgacactgtcaagggacattctttctcga |
170 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28635630 |
atgtgtatatgatgacatagacataccattgcaataccgtctctagcagatagagcgacaatgtcagcgcatgacactgtcaagggacattctttctcga |
28635531 |
T |
|
| Q |
171 |
cagcagctttgatggtgttcacatacttgaagtttctcatcccaaaacttctcactgatctctgctcc |
238 |
Q |
| |
|
|||| ||||||||||| |||||||||||||| ||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
28635530 |
cagctgctttgatggtattcacatacttgaaatttctcatcccaaaacttctcaccgatgtctgctcc |
28635463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 91 - 223
Target Start/End: Complemental strand, 28605442 - 28605310
Alignment:
| Q |
91 |
acataccattgcaataccgtctctcgcagaaagagcgacaatgtcagcacatgacactgtcaagggacattctttctcgacagcagctttgatggtgttc |
190 |
Q |
| |
|
||||||| | |||||||||||||| ||||||||||| ||||||||||| |||||||||||||| ||||||||||| || | |||||||||||||||| || |
|
|
| T |
28605442 |
acataccctggcaataccgtctctagcagaaagagcaacaatgtcagcgcatgacactgtcaaaggacattctttttcaagagcagctttgatggtgctc |
28605343 |
T |
|
| Q |
191 |
acatacttgaagtttctcatcccaaaacttctc |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
28605342 |
acatacttgaagtttctcatcccaaaacttctc |
28605310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 90 - 234
Target Start/End: Complemental strand, 28663294 - 28663150
Alignment:
| Q |
90 |
aacataccattgcaataccgtctctcgcagaaagagcgacaatgtcagcacatgacactgtcaagggacattctttctcgacagcagctttgatggtgtt |
189 |
Q |
| |
|
|||||||||| ||||| |||||||| || |||||||| |||||||| |||||||| ||||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
28663294 |
aacataccatggcaattccgtctctagcggaaagagcaacaatgtcggcacatgatactgtcaagggacattctttctccacagcagctttgatggtttt |
28663195 |
T |
|
| Q |
190 |
cacatacttgaagtttctcatcccaaaacttctcactgatctctg |
234 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| ||||| |||| |
|
|
| T |
28663194 |
tacatacttgaagtttcgcatcccggaacttctctctgatgtctg |
28663150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University