View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17617_low_24 (Length: 216)
Name: NF17617_low_24
Description: NF17617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17617_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 30 - 197
Target Start/End: Original strand, 55172782 - 55172949
Alignment:
| Q |
30 |
agcagaacctgtgcttgttccaggcttctcaaagattctaacctgcacgatgcattatatatttctcaaagttatcatgatggagatacacgcatgttgc |
129 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
55172782 |
agcagaacatgtgcttgttccaggcttctcaaagattctaacctgcacgatgcattatatatttctcaaagttatcatgatagagatacacgcatgttgc |
55172881 |
T |
 |
| Q |
130 |
atatatagcttaacaatgattattatatgtacctcgtggtagtcgttgagcttttggacagtgggaac |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55172882 |
atatatagcttaacaatgattattatatgtacctcgtggtagtcgttgagcttttggacagtgggaac |
55172949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University