View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17617_low_9 (Length: 333)
Name: NF17617_low_9
Description: NF17617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17617_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 8e-49; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 14474047 - 14473916
Alignment:
| Q |
1 |
gcaagttaacggtcatttaaaccgtcaacctctttctaatatgtgacctttattaaaccaatgttttacgtcctattttgtttatgcacatgtatannnn |
100 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14474047 |
gcaagttaacggttatttaaaccttcaacctctttctaatatgtgacctttattaaaccaatgttttacgtcctattttgtttatgcacatgtatatttt |
14473948 |
T |
 |
| Q |
101 |
nnnggcttagttgcatgtttggccccttacgt |
132 |
Q |
| |
|
||||||||||||||||| ||||||||||| |
|
|
| T |
14473947 |
tttggcttagttgcatgtttagccccttacgt |
14473916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 135 - 231
Target Start/End: Complemental strand, 14472838 - 14472742
Alignment:
| Q |
135 |
tagtgccgcccaatatagttcatgtgcttccgaaaattgctatgtggtcccttttgaatgtaaatggttgtctgaaaaatgccatatttcctttaaa |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14472838 |
tagtgccgcccaatatagttcatgtgcttccgaaaattgctatgtggtcccttttgaatgtaaatggttgtctgaaaaatgccatatttcttttaaa |
14472742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 230 - 311
Target Start/End: Complemental strand, 14472718 - 14472641
Alignment:
| Q |
230 |
aacagtaagtttctttgtcttctgcagcaacaatgtagatgtttatttcttttaccaagcaaactcacgcaaagaacaaggt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| ||||||||||||| |
|
|
| T |
14472718 |
aacagtaagtttctttgtcttctgcagcaacaatgtagatgtttatttctttcaccaag----ctcacacaaagaacaaggt |
14472641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 254 - 289
Target Start/End: Complemental strand, 14478558 - 14478523
Alignment:
| Q |
254 |
cagcaacaatgtagatgtttatttcttttaccaagc |
289 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14478558 |
cagcaacaatgtagatgtttatttctttcaccaagc |
14478523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University