View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17618_low_6 (Length: 228)

Name: NF17618_low_6
Description: NF17618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17618_low_6
NF17618_low_6
[»] chr3 (1 HSPs)
chr3 (1-193)||(32561025-32561218)


Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 32561218 - 32561025
Alignment:
1 acccgaggctgaggatgcatgggtcctgaacggaaagctctctgtatatctaataacgaaatcaggtcaaacaaaaatttcatggatgcattacagattc 100  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32561218 acccgaggctgaggatgcatgggtcctgaacgaaaagctctctgtatatctaataacgaaatcaggtcaaacaaaaatttcatggatgcattacagattc 32561119  T
101 aaattcaatataatttgtagttcaatttcaattttcaacaaaagcaataataaaacaaattgaaaaccctaacaatt-aaaagagtgtgtaatt 193  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
32561118 aaattcaacataatttgtagttcaatttcaattttcaacaaaagcaataataaaacaaattgaaaaccctaacaattaaaaagagtgtgtaatt 32561025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University