View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17619_low_1 (Length: 230)
Name: NF17619_low_1
Description: NF17619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17619_low_1 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 53674759 - 53674530
Alignment:
| Q |
1 |
attcaaatcatttataaagatctaagcatttgacaaccccctttatcattttttatagaattggcacctctaaaggaattaccaagtattgctttgagca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53674759 |
attcaaatcatttataaagatctaagcatttgacaaccccctttatcattgtttatagaattggcacctctaaaggaattaccaattattgctttgagca |
53674660 |
T |
|
| Q |
101 |
tgtgcatgaaggctgcacaattgtctcagttggaaggagcacaaaaacagaacagaatatcaattcaacagattttcaaggtaattcaatttttctaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
53674659 |
tgtgcatgaaggctgcacaattgtctcagttggaaggaacacaaaaacagaacagaatatcaattcaacagattttcaaggtaattcagtttttctaaag |
53674560 |
T |
|
| Q |
201 |
taatgttaattaacaaaatacaaatcaaat |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
53674559 |
taatgttaattaacaaaatacaaatcaaat |
53674530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University