View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1761_high_11 (Length: 331)
Name: NF1761_high_11
Description: NF1761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1761_high_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 5e-56; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 177 - 317
Target Start/End: Complemental strand, 35093175 - 35093037
Alignment:
| Q |
177 |
gtgttcatatctatgca--tatctctattacgttgctgggttagtttcaatgttttatttaattcccagtgtaattaaagaggtgaggttagtatattgg |
274 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35093175 |
gtgttcatatctatgcaaatatctctattacgttgctgggttagtttcaatgtttta----attcccagtgtaattaaagaggtgaggttagtatattgg |
35093080 |
T |
|
| Q |
275 |
agagttgaggagaacaagaggttaatgtaaataatgaatttga |
317 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35093079 |
agagttgaggagaacaagagcttaatgtaaataatgaatttga |
35093037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 10 - 105
Target Start/End: Complemental strand, 35093348 - 35093243
Alignment:
| Q |
10 |
agatgaagtgagtcttcaaaaattaagaaagatttgtattcatgggaaggaagaaatg----------aaatcaaatatgatcatgaatgaggggttggc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
35093348 |
agatgaagtgagtcttcaaaaattaagaaagaattgtattcatgggaaggaagaaatgaaatgaaatgaaatgaaatatgatcatgaatgaggggttggc |
35093249 |
T |
|
| Q |
100 |
aacaaa |
105 |
Q |
| |
|
|||||| |
|
|
| T |
35093248 |
aacaaa |
35093243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University