View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1761_high_17 (Length: 302)
Name: NF1761_high_17
Description: NF1761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1761_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 18 - 288
Target Start/End: Complemental strand, 43650562 - 43650292
Alignment:
| Q |
18 |
aacaccgtcgtttcgcacttctgcatgcgcaccaatgtcgacgcagcaccacgttcgcgacacaatcgaactcactaccatcgagaagagcatcttcgat |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43650562 |
aacaccgtcatttcgcacttctgcatgcgcaccaatgtcgacgcagcaccacgttcgcgacacaatcgaactcactaccatcgagaagagcatcttcgat |
43650463 |
T |
|
| Q |
118 |
aggcttctcgccactctccgtcactttcaactccaaactcagctccgtgtcgccggtggctgggttcgagataaggtttgcgcaaatttcaattgttcga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43650462 |
aggcttctcgccactctccgtcactttcaactccaaactcagctccgtatcgccggtggctgggttcgagataaggtttgtgcaaatttcaattgttcga |
43650363 |
T |
|
| Q |
218 |
atcattctttgcactaatgaattgtttactgctacgttcttgaaatgttaattggttattttgtgtttgat |
288 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43650362 |
atcattctttgcactaattaattgtttactgctacgttcttgaaatgttaattggttattttgtgtttgat |
43650292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 37 - 227
Target Start/End: Complemental strand, 43619510 - 43619317
Alignment:
| Q |
37 |
tctgcatgcgcaccaatgtcgacgcag---caccacgttcgcgacacaatcgaactcactaccatcgagaagagcatcttcgataggcttctcgccactc |
133 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||| |||| | | ||||||||||| ||||||||||||| |
|
|
| T |
43619510 |
tctgcatgcgcatcaatgtcgacgcagacgcaccatgttcgtgacacaatcgaactcaccgaagtcgaacaaaaaatcttcgatagacttctcgccactc |
43619411 |
T |
|
| Q |
134 |
tccgtcactttcaactccaaactcagctccgtgtcgccggtggctgggttcgagataaggtttgcgcaaatttcaattgttcgaatcattcttt |
227 |
Q |
| |
|
| |||||| ||||| ||||| | |||| ||||||||||| |||||||| ||||||||||| |||||| |||| ||| |||||||||||| |
|
|
| T |
43619410 |
aacttcacttcaaactcaaaactgacatccgagtcgccggtggttgggttcgcgataaggtttgtacaaattacaatcgttggaatcattcttt |
43619317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University