View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1761_low_16 (Length: 310)
Name: NF1761_low_16
Description: NF1761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1761_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 14442735 - 14442600
Alignment:
| Q |
1 |
ttaaggggactaataaagtattcttttgaatgtgtaattagttatggttattgtaattttttaccgatgtaattctcaatgttttgattggttatgcgta |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
14442735 |
ttaagtggactaataaagtattcttttgaatgtgtaattagttatggttattgtaattttttaccaatgtaattctgaatgttttgattggttatgcgta |
14442636 |
T |
 |
| Q |
101 |
aagtcgttttagaatgtcaacctaacaacattaaac |
136 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14442635 |
aagtcgttttggaatgtcaacctaacaacattaaac |
14442600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 197 - 296
Target Start/End: Complemental strand, 14442539 - 14442440
Alignment:
| Q |
197 |
tgaaaataatgtccactagtcaacatgtgttgtcgtatgtttgtggtcactgatctgctctgttatacaaaacatcaatcctagtaacacaatcctggtc |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14442539 |
tgaaaataatgtccactagtcaacatgtgttgtcgtatgtttgtggtcactgatctggtctgttagacaaaacatcaatcctagtaacacaatcctggtc |
14442440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University