View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1761_low_29 (Length: 202)
Name: NF1761_low_29
Description: NF1761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1761_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 14 - 181
Target Start/End: Original strand, 38823546 - 38823712
Alignment:
| Q |
14 |
aaacataggcgactaacaagataattattgacataatcaagaaaaatgtcaaaagatcgattgaaaatgtggcatgaaagtttacaaaatgttattccgg |
113 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38823546 |
aaacaaaggtgactaacaagataattattgacataatcaagaaaaatgtcaaa-gatcgactgaaaatgtggcatgaaagtttacaaaatgttattccga |
38823644 |
T |
|
| Q |
114 |
ctattagaaattctaaaacgattcctaatggttttactccttatcaactcatatacgatcaagataag |
181 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38823645 |
ctattaaaaattctaaaacagttcctaatggttttactccttatcaactcatatacgatcaagataag |
38823712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University