View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17620_high_5 (Length: 282)
Name: NF17620_high_5
Description: NF17620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17620_high_5 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 22939039 - 22938758
Alignment:
| Q |
1 |
tttggtatggtttggattttcggtttcatttgctcaaaaaatcggttataaaactacttatgttaattatctaccttagagctatgcatggtcactacaa |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||| |||| |
|
|
| T |
22939039 |
tttgatatggtttggattttcggtttcatttgctcaaaaaatcggttataaaactacttatgttatttatctaccttagagctattcattgtcacaacaa |
22938940 |
T |
 |
| Q |
101 |
atgtacaacaccgcacttcaatacgccttctcttgctagaaatacctattataagtgacaaaatagatggtttggatggacatgaatttatatgaaaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22938939 |
atgtacaacaccgcacttcaatacgccttttcttgctagaaatacctgttataagtgacaaaatagatggtttggatggacatggatttatatgaaaatt |
22938840 |
T |
 |
| Q |
201 |
aatcgatctgacatggatttatcaataaacgagttgaatggatatatatttggtgggttaaattgccactctattacccaaa |
282 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
22938839 |
aatcgatctaacatggatttatcaataaacgagttgaatggatatatatttgatgggttaaattgccagtctattacccaaa |
22938758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University