View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17623_low_3 (Length: 254)
Name: NF17623_low_3
Description: NF17623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17623_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 35212292 - 35212052
Alignment:
| Q |
1 |
tgagttcaatgatttctaaaccaatctagtaagatataattgaatttt-gtgcatagtcattaaactcatattttaaccaattacattaatgtctcttaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35212292 |
tgagttcaatgatttctaaaccaatctagtaagatataattgaattttagtgcatagtcattaaactcatattttaaccgattacattaatgtctcttaa |
35212193 |
T |
|
| Q |
100 |
gtcttacccctgcaggaaagatcacggatcctattgcgtgttgctgatttggttgagaaacacaacgatgaacttgcggcattggaaacatggaataacg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35212192 |
gtcttacccctgcaggaaagatcacggatcctattgcgtgttgctgatttggttgagaaacacaacgatgaacttgcggcattggaaacatggaataacg |
35212093 |
T |
|
| Q |
200 |
gcaagctttatgagcaagctgtaaatattgaagtgcctatg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35212092 |
gcaagctttatgagcaagctgtaaatattgaagtgcctatg |
35212052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University