View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17624_low_1 (Length: 221)
Name: NF17624_low_1
Description: NF17624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17624_low_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 11 - 211
Target Start/End: Complemental strand, 40379965 - 40379765
Alignment:
| Q |
11 |
acacataccttaattccgttaaattcattgtcaatcaaaacatgcatcaagtcaaatcacattacagattcaagaatccaagcgacaaaattgttgtcat |
110 |
Q |
| |
|
||||| ||| ||| ||||||||||||| || ||||||||||||||| ||||||||| |||||||| || ||||||||||||||||||||||||||| | |
|
|
| T |
40379965 |
acacacaccctaactccgttaaattcacagtaaatcaaaacatgcattaagtcaaattacattacatatggaagaatccaagcgacaaaattgttgtcgt |
40379866 |
T |
 |
| Q |
111 |
attattaggattaagagcaatgatcctaatactctaaaatacaacttctcatcctatacaaaactcaatggagcaaaactagacagcatttgaagtataa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40379865 |
attattaggattaagagcaatgatcctaatactctaaaatacaacttctcatcctatacaaaactcaatggagcaaaactagacagcatttgaagtataa |
40379766 |
T |
 |
| Q |
211 |
t |
211 |
Q |
| |
|
| |
|
|
| T |
40379765 |
t |
40379765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University