View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17625_high_43 (Length: 278)
Name: NF17625_high_43
Description: NF17625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17625_high_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 6e-43; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 7 - 95
Target Start/End: Original strand, 1316957 - 1317045
Alignment:
| Q |
7 |
ctgaaatgaatcatctgctgcctactcccttcctaacctgtctgctctgctgccactttatatgtctccttctctcttgtcattacctc |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1316957 |
ctgaaatgaatcatctgctgcctactcccttcctaacctgtctgctctgctgccactttatatgtctccttctctcttgtcattacctc |
1317045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 147 - 240
Target Start/End: Original strand, 1317647 - 1317742
Alignment:
| Q |
147 |
atgttaccaactctctcaatattaccggtgtttcttctnnnnnnn--tgcctaaggtgtgatttatctaccaatattaagttgattaaacactttt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1317647 |
atgttaccaactctctcaatattaccggtgtttcttctaaaaaaaaatgcctaaggtgtgatttatctaccaatattaagttgattaaacactttt |
1317742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 222 - 262
Target Start/End: Original strand, 1317778 - 1317818
Alignment:
| Q |
222 |
aagttgattaaacacttttaatgggatctctttttccactt |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1317778 |
aagttgattaaacacttttaatgggatctctttttccactt |
1317818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 113 - 143
Target Start/End: Original strand, 1317596 - 1317626
Alignment:
| Q |
113 |
gtttctctcctcacagttacgaaatcaccat |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1317596 |
gtttctctcctcacagttacgaaatcaccat |
1317626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University