View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17625_high_45 (Length: 276)
Name: NF17625_high_45
Description: NF17625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17625_high_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 45 - 267
Target Start/End: Complemental strand, 5754576 - 5754360
Alignment:
| Q |
45 |
tccatatccgtcctaataccccatgatattttcttctgccatcgatgattggaatttgaaactaagtttatccc-aacgattatatatctccttttacta |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
5754576 |
tccatatccgtcctaataccccatgatattttcttctgc-------gattggaatttgaaactaagtttacccccaacgattatatatctccttttacta |
5754484 |
T |
|
| Q |
144 |
tgtgtatatatccaaatcaccattaatgttttttggtcaagaaaaaacaccatttatgttaactgtgnnnnnnnctgaccgtgnnnnnnncattcttttc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
5754483 |
tgtgtatatatccaaatcaccattaatgttttttggtcaagaaaaaacaccatttatgttaactgtgtttttttctgaccgtgtttttttcattcttttc |
5754384 |
T |
|
| Q |
244 |
taaatcaaatggatctcttcatct |
267 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5754383 |
taaatcaaatggatctcttcatct |
5754360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University