View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17625_high_50 (Length: 261)
Name: NF17625_high_50
Description: NF17625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17625_high_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 22 - 251
Target Start/End: Original strand, 12928612 - 12928841
Alignment:
| Q |
22 |
ctaggttacccggacaatatcaagatgctcgggaagctattttgtgggtgaaaaaccaaatgacgggtcctaatggagagaaatggctgagagactatgg |
121 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12928612 |
ctaggttaccaggacaatatcaagatgctcgggaagctattttgtgggtgaaaaaccaaatgacgggtcctaatggagagaaatggctgagagactatgg |
12928711 |
T |
 |
| Q |
122 |
tgacccatcaaggtgttatctttatggatgtggttgtggtgcaaacattgtgttcaatacggccttgcagattggagatgtggacttagagcctctaaga |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12928712 |
tgacccatcaaggtgttatctttatggatgtggttgtggtgcaaacattgtgttcaatacggccttgcagattggagatgtggacttagagcctctaaga |
12928811 |
T |
 |
| Q |
222 |
atttgtggccttgttatgaatcaacctatg |
251 |
Q |
| |
|
||| |||||||||||||||||||||||||| |
|
|
| T |
12928812 |
attagtggccttgttatgaatcaacctatg |
12928841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University