View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17625_high_53 (Length: 230)
Name: NF17625_high_53
Description: NF17625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17625_high_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 16 - 215
Target Start/End: Complemental strand, 43476374 - 43476175
Alignment:
| Q |
16 |
cagatactttatttttgttacaccctcatttatgccaaatgtccccctctcgaagaccgacttattcctagtgatccataatgaccaaattacagccaac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43476374 |
cagatactttatttttgttacaccctcatttatgccaaatgtccccctctcaaagaccgactcattcctagtgatccataatgaccaaattacagccaac |
43476275 |
T |
 |
| Q |
116 |
caaatgagatgtctcaacctcctccgtcttcttcctctagcaagaatgtgatgatgactgagtaaagtgatatacactgcaatttgcataagcgcctttg |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
43476274 |
caaatgagatgtctcaacctcttccgtctttttcctctagcaagaatgtgatgatgactgagtaaagtgatctacactgctatttgcataagcgcctttg |
43476175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 16 - 215
Target Start/End: Original strand, 43563934 - 43564118
Alignment:
| Q |
16 |
cagatactttatttttgttacaccctcatttatgccaaatgtccccctctcgaagaccgacttattcctagtgatccataatgaccaaattacagccaac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43563934 |
cagatactttatttttgttacaccctcatttatgccaaatgtccccctctcaaagaccgacttattcctagtgatccataatgacca------------- |
43564020 |
T |
 |
| Q |
116 |
caaatgagatgtctcaacctcctccgtcttcttcctctagcaagaatgtgatgatgactgagtaaagtgatatacactgcaatttgcataagcgcctttg |
215 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
43564021 |
--aatgagatgtctcaacctcttccgtcttcttcctctagcaagaatgtgatgatgactgagtaaagtgatctacactgctatttgcataagcgcctttg |
43564118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University