View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17625_high_56 (Length: 212)
Name: NF17625_high_56
Description: NF17625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17625_high_56 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 17 - 194
Target Start/End: Complemental strand, 50966751 - 50966577
Alignment:
| Q |
17 |
aatattcaatatggtatcacttttaatttttattgttggtattatgaataa-tggtttatatacccacttctgaaattcttttaaggattaaaatgtagc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50966751 |
aatattcaatatggtatcacttttaatttttattgttggtattatgaataaatggtttatatacccacttctgaaattcttttaaggattaaaatgtagc |
50966652 |
T |
 |
| Q |
116 |
ctaacccgattgagtacccgttaaacnnnnnnngtatttaattcgttttgttaaaagaaatcaaatttcgtagtggtag |
194 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50966651 |
ctaacccgattgagtacccgttata----ttttgtatttaattcgttttgttaaaagaaatcaaatttcgtagtggtag |
50966577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 17 - 194
Target Start/End: Complemental strand, 51069886 - 51069712
Alignment:
| Q |
17 |
aatattcaatatggtatcacttttaatttttattgttggtattatgaataa-tggtttatatacccacttctgaaattcttttaaggattaaaatgtagc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51069886 |
aatattcaatatggtatcacttttaatttttattgttggtattatgaataaatggtttatatacccacttctgaaattcttttaaggattaaaatgtagc |
51069787 |
T |
 |
| Q |
116 |
ctaacccgattgagtacccgttaaacnnnnnnngtatttaattcgttttgttaaaagaaatcaaatttcgtagtggtag |
194 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51069786 |
ctaacccgattgagtacccgttata----ttttgtatttaattcgttttgttaaaagaaatcaaatttcgtagtggtag |
51069712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University