View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17625_low_11 (Length: 442)
Name: NF17625_low_11
Description: NF17625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17625_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 5e-63; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 158 - 315
Target Start/End: Original strand, 56342948 - 56343108
Alignment:
| Q |
158 |
caacaaccactcttcctcttcccttcttgctagtttagaagacagtttgagtgatgcaaacaacgctgatggtttc---ttcgattcaaagagtgatgtt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
56342948 |
caacaaccactcttcctcttcccttcttgcaagtttagaagacagtttgagtgatgcaaacaacgctgatgatgctggtttcgattcaaagagtgatgtt |
56343047 |
T |
 |
| Q |
255 |
gggacccgctcctcctttttcagatattcaaatccaagaacaacaatccctccccctcttc |
315 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
56343048 |
gggacccgctcctcctttttcagaaattcaaatccaagaacaacaatccctccccctcttc |
56343108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 387 - 435
Target Start/End: Original strand, 56343180 - 56343228
Alignment:
| Q |
387 |
gatgactctggagatgattattctaactccatttccggtgcttcatctc |
435 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
56343180 |
gatgactctggagatgattattctaactccatttccggtgcttcttctc |
56343228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 13 - 43
Target Start/End: Original strand, 56342797 - 56342827
Alignment:
| Q |
13 |
tcagaaatcccaattcacttcctacttcctc |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
56342797 |
tcagaaatcccaattcacttcctacttcctc |
56342827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University