View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17625_low_21 (Length: 370)
Name: NF17625_low_21
Description: NF17625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17625_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 1 - 153
Target Start/End: Complemental strand, 16690080 - 16689928
Alignment:
| Q |
1 |
atgagctacgccgaaatcttgatgtcatagagatactaaagaacactcagtttcctaagatttgcaagaatcagtacagtaggatgcctgacaaaatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16690080 |
atgagctacgccgaaatcttgatgtcatagagatactaaagaacactcagtttcctaagatttgcaagaatcagtacagtaggatgcctgacaaaatttt |
16689981 |
T |
 |
| Q |
101 |
agatcacgagtaagtatcattcaaaactagttttaaagttataatgcagagac |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16689980 |
agatcacgagtaagtatcattcaaaactagttttaaagttataatgcagagac |
16689928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 236 - 352
Target Start/End: Complemental strand, 16689835 - 16689719
Alignment:
| Q |
236 |
ctccagccgaattatatggttcggggacttgaattacagaatttctttgagtcgcgatgttgctaaaaggcttgtggaaatgaaggattggcctgcacta |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16689835 |
ctccagccgaattatatggttcggggacttgaattacagaatttctttgagtcgcgatgttgctaaaaggcttgtggaaatgaaggattggcctgcacta |
16689736 |
T |
 |
| Q |
336 |
tttaacaaggatcaggt |
352 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
16689735 |
tttaacaaggatcaggt |
16689719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University