View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17625_low_41 (Length: 284)
Name: NF17625_low_41
Description: NF17625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17625_low_41 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 8 - 284
Target Start/End: Complemental strand, 33274724 - 33274448
Alignment:
| Q |
8 |
aaataatacttataatcccaagacaatgtgcatgtaatatattaatccaatttgcttgctgaaaagcttaacaactttttcacacacatatatataaagt |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33274724 |
aaattatacttataatcccaagacaatgtgcatgtaatatattaatccaatttgcttgctgaaaagcttaacaactttttcacacacatatatataaagt |
33274625 |
T |
 |
| Q |
108 |
ctcatagcttgcaaattacaacatgaaaaattaagtaatagctagccttccattatatcttcatatcacaacatc-tttccactcaaatacaatttcttg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33274624 |
ctcatagcttgcaaattacaacatgaaaaattaagtaatagctagccttccattatatcttcatatcacaacatcttttccactcaaatacaatttcttg |
33274525 |
T |
 |
| Q |
207 |
nnnnnnnctttgtgatggaaattcaatttcagcaaccaaacatgcagaatcagaaagcaggaatttcagtaaccaaca |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33274524 |
-aaaaaactttgtgatggaaattcaatttcagcaaccaaacatgcagaatcagaaagcaggaatttcagtaaccaaca |
33274448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University