View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17625_low_45 (Length: 276)

Name: NF17625_low_45
Description: NF17625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17625_low_45
NF17625_low_45
[»] chr1 (1 HSPs)
chr1 (45-267)||(5754360-5754576)


Alignment Details
Target: chr1 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 45 - 267
Target Start/End: Complemental strand, 5754576 - 5754360
Alignment:
45 tccatatccgtcctaataccccatgatattttcttctgccatcgatgattggaatttgaaactaagtttatccc-aacgattatatatctccttttacta 143  Q
    |||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||| ||| |||||||||||||||||||||||||    
5754576 tccatatccgtcctaataccccatgatattttcttctgc-------gattggaatttgaaactaagtttacccccaacgattatatatctccttttacta 5754484  T
144 tgtgtatatatccaaatcaccattaatgttttttggtcaagaaaaaacaccatttatgttaactgtgnnnnnnnctgaccgtgnnnnnnncattcttttc 243  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||       ||||||||||    
5754483 tgtgtatatatccaaatcaccattaatgttttttggtcaagaaaaaacaccatttatgttaactgtgtttttttctgaccgtgtttttttcattcttttc 5754384  T
244 taaatcaaatggatctcttcatct 267  Q
    ||||||||||||||||||||||||    
5754383 taaatcaaatggatctcttcatct 5754360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University